Menu Fermer

Présence de la patate douce en Océanie

Les collections historiques révèlent des modèles de diffusion de la patate douce en Océanie masqués par des mouvements de plante moderne et une recombinaison.

CAROLINE ROULLIER, Centre de Coopération Internationale en Recherche Agronomique pour le Développement-Systèmes Biologiques-, Unité Mixte de Recherche Amélioration Génétique et Adaptation des Plantes & Centre National de la Recherche Scientifique, Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier, France.
LAURE BENOIT, Centre National de la Recherche Scientifique, Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier, France.
DOYLE B. McKEY, Centre National de la Recherche Scientifique, Centre d’Ecologie Fonctionnelle et Evolutive & Institut universitaire de France et université Montpellier II, Montpellier , France.
VINCENT LEBOT, Centre de Coopération Internationale en Recherche Agronomique pour le Développement-Systèmes Biologiques-, Unité Mixte de Recherche Amélioration Génétique et Adaptation des Plantes, Montpellier, France.

Résumé

L’histoire de la patate douce dans le Pacifique a longtemps été une énigme. Les données archéologiques, linguistiques et ethnobotaniques suggèrent que des événements préhistoriques de dispersion, provoqués par l’homme, ont contribué à la distribution en Océanie de ce produit domestique américain. Selon l’hypo- thèse tripartite, la patate douce a été introduite en Océanie à partir de l’Amérique du Sud à l’époque précolombienne, puis a été introduite plus tard, et largement diffusée dans le Pacifique par les Européens, par deux itinéraires historiquement documentés en provenance du Mexique et des Caraïbes. Bien que la patate douce soit l’exemple le plus convaincant des liens présumés précolombiens entre les populations polynésiennes et celles d’Amérique du Sud, la recherche de preuves génétiques de la dispersion précolombienne de la patate douce en Océanie n’a pas été concluante. Notre étude tente de combler cette lacune. En utilisant des ensembles de marqueurs complémentaires (chloroplastes et microsatellites nucléaires) et des échantillons modernes avec ceux d’herbiers, nous testons l’hypotèse tripartite. Nos résultats soutiennent fortement le(s) transfert(s) préhistorique(s) de patate douce d’Amérique du Sud (région Pérou-Equateur) en Polynésie. Nos résultats documentent également un changement temporel dans le schéma de distribution de la variation génétique de la patate douce en Océanie. Les réintroductions ultérieures, accompagnées d’une recombinaison entre des pools génétiques distincts de patates douces, ont remanié la base génétique initiale de la culture, obscurcissant les schémas de diffusion primaires et, en même temps, donnant naissance à un nombre impressionnant de variantes locales. Notre étude montre également que les phénotypes, les noms et les gènes neutres ne partagent pas nécessairement des histoires évolutives complètement parallèles. Des approches pluridisciplinaires semblent donc nécessaires pour reconstituer avec précision les histoires entrelacées des plantes et des hommes.

Mots-clés

Phylogéographie – Herbiers – Préhistoire – Premiers voyages transpacifiques

Les efforts déployés pour comprendre la mobilité humaine et l’évolution culturelle dans le Pacifique ont englobé des approches archéologiques, ethnographiques, linguistiques et, plus récemment, génétiques (1, 2). Les analyses génétiques ont porté non seulement sur les populations humaines (3, 4) mais aussi sur celles d’espèces étroitement associées aux mouvements humains (5-13), notamment les animaux commensaux (Rattus exulans) (5, 6), les plantes à métissage [gourde, Lagenaria siceraria (7, 8) ; banana, Musa spp. (9)] et les animaux [poulet, Gallus gallus (10, 11) ; porc, Sus scrofa (12)], et les agents pathogènes (Helicobacter pylori) (13). L’étude des espèces commensales est particulièrement utile dans les contextes où la mobilité n’implique pas nécessairement un flux de gènes entre les populations humaines ou lorsque les données archéologiques sont limitées (14). Ces études ont fourni les meilleures preuves à ce jour pour aborder la question controversée des contacts entre la Polynésie et les Amériques à l’époque préhistorique (8, 10, 14, 15). La patate douce (Ipomoea batatas [L.] Lam.) en Océanie est sans aucun doute l’ex ante la plus convaincante de ces contacts (14).

La patate douce est originaire de l’Amérique tropicale (16). Le moment, le lieu et la manière dont elle a ensuite atteint l’Océanie ont fait l’objet d’un vaste débat. Sa présence dans des sites archéologiques pré-contacts dispersés dans toute la Polynésie a longtemps été considérée comme la preuve directe d’un contact préhistorique entre la Polynésie et l’Amérique (17-21). De plus, la similitude lexicale entre les termes de la patate douce dans les langues polynésiennes («kuumala» et ses dérivés) et les termes de cette plante («kumara», «cumar» ou «cumal») trouvés chez les locuteurs quechuas du nord-ouest de l’Amérique du Sud soutient l’hypothèse selon laquelle l’homme a introduit la patate douce d’Amérique du Sud en Polynésie (22), contre l’hypothèse alternative de la dispersion naturelle des graines sur de longues distances (23). Enfin, l’hypothèse tripartite, d’abord proposée par Barrau (24), développée par Yen (25), récemment mise à jour par Green (26) et revue par Clarke (27), postule des événements de dispersion à la fois préhistoriques et historiques, mettant en avant une origine tripartite pour expliquer la répartition de l’espèce (Fig. 1). Dans la première origine, la patate douce polynésienne (lignée Kumara) a été introduite par des voyageurs polynésiens qui l’ont récoltée quelque part sur la côte ouest de l’Amérique du Sud, entre 1000 et 1100 après J.-C. (26, 27). Ils l’ont peut-être rapidement diffusée dans toute la Polynésie, sur des terres déjà peuplées comme Hawaï, l’île de Pâques et quelques autres îles de la Polynésie orientale, puis en Nouvelle-Zélande, vers 1150-1250 après J.-C., avec les premiers colons. D’autres introductions préhistoriques indépendantes (en provenance du nord de la Colombie ou même de l’Amérique centrale) ont également été supposées, mais elles ne sont pas étayées (23, 28). De plus, les premiers récits historiques suggèrent la possibilité d’une dispersion précoce vers l’ouest de patates douces transportées par les Polynésiens vers les Tonga, Samoa et la Mélanésie orientale (26, 29). Les deuxième et troisième origines de la patate douce en Océanie sont issues de contacts européens au cours du XVIe siècle. Les galions espagnols «Manille-Acapulco» ont introduit le Camote mésoaméricain aux Philippines vers 1500 après J.-C. (lignée Camote), tandis que les commerçants portugais ont introduit dans l’actuelle Indonésie orientale les Batata des Caraïbes et d’Amérique centrale (lignée Batata). À partir de ces points, des événements de dispersion secondaire, sous l’influence de commerçants locaux, de voyageurs européens ou des deux, ont pu distribuer la patate douce dans le Pacifique occidental, probablement au début des hauts plateaux de Nouvelle-Guinée (vers 1700), et beaucoup plus tard (milieu du XIXe siècle) dans l’ouest et l’est de la Mélanésie (Fig. 1). Deux autres introductions européennes peuvent également avoir contribué à une diffusion précoce dans le Pacifique, l’une par le voyage de Mendaña aux Marquises et aux îles Salomon en 1595 après J.-C. et l’autre par Queiros à Espíritu Santo (une partie de l’actuel Vanuatu) en 1606 après J.-C. (30).

L’hypothèse tripartite était principalement basée sur des preuves archéologiques, historiques et linguistiques (25, 26). Malheureusement, Les études phylogéographiques ne l’ont pas encore suffisamment testée (27, 31- 33). Les modèles génétiques attendus dans le cadre de cette hypothèse comprennent une distinction entre les cultures du Pacifique Est et Ouest, dans laquelle les variétés du Pacifique Ouest pourraient être plus proches de celles de la Mésoamérique, alors que celles du Pacifique Est sont plus proches de celles de l’Ouest de l’Amérique du Sud. Des tentatives antérieures d’élucidation des origines de la patate douce en Océanie à l’aide de marqueurs moléculaires ont montré que les variétés du Pacifique étaient plus proches génétiquement des accessions mexicaines que de celles du Pérou-Équateur, soutenant une origine mésoaméricaine plutôt que des transferts polynésiens précoces d’Amérique du Sud (31-33). Cependant, ces études ont souffert d’un échantillon très restreint, comprenant très peu de variétés polynésiennes. Plus récemment, Clarke (27), à l’aide de marqueurs AFLP (Amplified Fragment Length Polymorphism), a analysé environ 300 variétés d’Océanie, dont des variétés polynésiennes. Cependant, cette étude n’a pas utilisé un échantillon représentatif des pools génétiques de source tropicale américaine et n’a donc pas réussi à retracer avec certitude l’origine des lignées du Pacifique existantes. En utilisant des marqueurs microsatellites nucléaires et chloroplastes, Roullier et al. (34) ont récemment mis en évidence l’existence de deux pools génétiques géographiquement limités en Amérique tropicale, correspondant aux accessions de la région Pérou-Équateur d’Amérique du Sud (ci-après appelé le pool génétique du Sud) et aux accessions de la région Caraïbes et Amérique centrale (ci-après appelé le pool génétique du Nord). Cet ensemble de marqueurs complémentaires fournit des outils appropriés pour distinguer les cultivars océaniens issus de la lignée Kumara (provenant du pool génétique du Sud) de ceux issus des lignées Batata et Camote (provenant du pool génétique du Nord).

Une autre limite à la compréhension de l’histoire de la patate douce en Océanie vient du fait que les modèles contemporains de sa variation génétique dans la région ne reflètent probablement pas les schémas initiaux. De tous les points d’entrée supposés, l’intensification des mouvements et des échanges humains à travers le Pacifique au XXe siècle a probablement étendu l’aire de répartition de la patate douce en Océanie, tout en redistribuant sa diversité génétique (25, 35). Par conséquent, les signatures génétiques des introductions initiales peuvent être au moins partiellement masquées par des introductions ultérieures provenant d’un contexte génétique différent. Il est donc nécessaire de comparer les schémas géographiques de variation génétique au fil du temps, en analysant des échantillons modernes et anciens (14, 36). Les vestiges archéologiques de patate douce sont rares dans le Pacifique et il est très peu probable qu’ils contiennent de l’ADN préservé. Toutefois, les spécimens d’herbiers, recueillis par les premiers explorateurs et naturalistes européens et, plus tard, par des botanistes et des agronomes, constituent des sources de matériel inestimables pour retracer les premiers mouvements des pools génétiques, en complément de l’échantillonnage des accessions modernes, qui ont été plus touchées par l’intensification des échanges de germoplasme au cours du XXe siècle.

La présente étude tente de combler le manque de données génétiques dans la reconstitution de l’histoire de la patate douce en Océanie. En utilisant un large échantillonnage d’accessions modernes et d’herbiers d’Amérique tropicale, d’Océanie et d’Asie du Sud-Est, ainsi que des marqueurs nucléaires et chloroplastiques de pools génétiques d’Amérique tropicale, nous avons vérifié si les preuves génétiques soutiennent ou invalident l’hypothèse tripartite.

Résultats et discussion

Résumé de la situation en Amérique tropicale

Comme indiqué dans une étude précédente (34) et résumé ici dans la Fig. 2 A-C, en combinant l’utilisation de marqueurs de chloroplastes et de microsatellites nucléaires, nous avons établi l’existence de pools génétiques distincts dans les régions nord et sud des néotropiques.

Fig 1 Patate Douce

Fig 1. Dispersion préhistorique et historique de la patate douce en Océanie, selon l’hypothèse tripartite. Cette carte résume l’hypo- thèse tripartite, telle que mise à jour par Green (26) et revue par Clarke (27). Les événements de dispersion et les termes couram- ment utilisés pour désigner la patate douce dans les différentes régions [compilés principalement à partir du yen (25)] sont repré- sentés. Les documents archéologiques et historiques anciens qui fournissent des preuves solides de la présence de la patate douce en Océanie à l’époque préhistorique sont également indiqués.

Les patates douces néotropicales sont caractérisées par deux lignées distinctes de chloroplastes géographique-ment limitées (au total 21 haplotypes), qui correspondent assez bien à deux groupes génétiques nucléaires, K1 et K2, identifiés par le groupement K-means (Fig. 2 A-C): la plupart des accessions de la région sud (ci-après le pool génétique du Sud) présentent des haplotypes de chloroplastes du groupe 1 (79,7%) et appartiennent au groupe nucléaire K1 (83%). Les patates douces de la région nord (ci-après le pool génétique du Nord) présentent principalement des haplotypes d’ADN chloroplastique du groupe 2 (85,6 %) et appartiennent au groupe nucléaire K2 (91,46 %).

Malgré ce schéma phylogéographique précis, les pools génétiques néotropicaux sont entrés en contact secondairement, comme le montre le mélange révélé par les marqueurs chloroplastiques et nucléaires (Fig. 2 A-C): dans la région du Sud, nous avons détecté des haplotypes du groupe 2 du chloroplaste (16/65), certains attribués au groupe nucléaire K2 [8/65 avec la méthode de l’analyse discriminante des composants princi- paux (DAPC) (37), 3/65 avec la méthode bayésienne de classification mise en œuvre dans la structure 2.3.3 (38, 39)], et certains qui étaient des individus mélangés (3/65 avec la méthode DAPC, 34/65 avec la méthode bayésienne). De plus, dans la région du Nord, nous avons identifié plusieurs accessions avec des haplotypes de chloroplastes du groupe 1 (31/82), certains attribués au groupe K1 (5/82 avec DAPC), et d’autres qui ont été mélangées (2/82 avec la DAPC, 49/82 avec la méthode bayésienne). Cette situation suggère que les clones ont été echangés entre les deux régions et recombinés avec du matériel local.

Évaluation de la contribution relative des lignées Camote, Batata et Kumara de patate douce introduites en Océanie dans l’échantillon moderne

Les variétés de patates douces en Océanie représentent un sous-ensemble de la diversité néotropicale pour les deux types de marqueurs. Elles comprennent des représentations des deux lignées néotropicales de chloroplastes 1 et 2 (au total huit haplotypes différents, y compris les plus courants en Amérique tropicale) ainsi que quelques haplotypes privés (huit), tous rares et dérivés des plus courants par seulement une ou deux étapes de mutation (Fig. S1 et Dataset S1). Les indices de diversité nucléaire [à l’exception de l’hétérozygotie observée (Ho)] étaient légèrement inférieurs à ceux calculés pour l’un ou l’autre des deux pools génétiques néotropicaux (tableau S1).

L’arbre voisin non raciné a révélé un degré relativement élevé de structure phylogéographique parmi les variétés océaniennes (Fig. 3). Comme prévu dans l’hypothèse tripartite, les variétés du Pacifique occidental (variétés d’Asie du Sud-Est, de Mélanésie et de Nouvelle-Guinée) sont différenciées de celles de Polynésie. Cependant, les incongruités entre les données sur le chloroplaste et le nucléaire empêchent, dans certains cas, l’attribution définitive de certaines variétés océaniennes à un pool génétique original en Amérique tropicale (Fig. 2C).

Capture D’écran 1

Fig. 2. Répartition géographique de la variation génétique nucléaire et chlo- roplastique de la patate douce dans l’espace et dans le temps. (A) Proportion d’individus appartenant à chaque lignée de chloroplastes [lignée 1 en orange (Cp 1) ; lignée 2 en bleu (Cp 2)] pour chaque site d’échantillonnage (pays ou archipel). Seuls les sites ayant quatre accessions ou plus ont été représentés. L’aire du cercle est proportionnelle à la racine carrée de la taille de l’échantillon pour le site. Les valeurs par région correspondent à la fréquence de la lignée de chloroplastes 1. (B) Proportion d’individus appartenant à chaque grappe nucléaire (grappe K1 en orange ; K2 en bleu) pour chaque site d’échantillonnage, telle que déterminée par l’analyse DAPC. Seuls les sites ayant quatre accessions ou plus ont été représentés. L’aire du cercle est proportionnelle à la racine carrée de la taille de l’échantillon pour le site. Les valeurs par région correspondent à l’ascendance K1 moyenne, telle que déterminée par l’agrégation bayésienne. (C) Trois diagrammes à barres indiquant pour chacun d’entre eux – en divisant: (i) les probabilités d’appartenance aux groupes nucléaires K1 et K2, telles que déterminées par la méthode DAPC (en haut) ; (ii) les probabilités d’appartenance aux groupes nucléaires K1 et K2, telles que déterminées par la méthode de groupement bayésien mise en œuvre dans Structure (au milieu) ; et (iii) la lignée chloroplastique de l’individu (en bas). Chaque individu est représenté par une barre verticale, dont les couleurs correspondent aux probabilités d’appartenance aux groupes K1 (orange), K2 (bleu) et aux lignées chloroplastiques 1 (orange) et 2 (bleu). Les individus sont organisés par origine géographique, S pour la région néotropicale du Sud, N pour la région néotropicale du Nord, P pour la Polynésie, M pour la Mélanésie, NG pour la Nouvelle-Guinée et SEA pour l’Asie du Sud-Est. (D) Constitution génétique des spécimens d’herbiers collectés du 18e siècle au début du 20e siècle. Les moitiés inférieure et supérieure de chaque cercle représentent respectivement la lignée chloroplastique et l’amas nucléaire (tel que déterminé par le DAPC).

En utilisant la méthode d’attribution non basée sur le modèle DAPC, la plupart des accessions de patates douces du Pacifique occidental (604 au total) ont été attribuées au groupe K2. Seules quatre accessions ont été attribuées au groupe K1, et 14 accessions présentaient une constitution génétique mixte (probabilité d’appartenance à un groupe donné, <0,8). Avec la méthode bayésienne de classification, 144 accessions ont été attribuées au groupe K2, et toutes les autres avaient une ascendance mixte. La proportion moyenne d’ascendance K1 était similaire (0,29 ± 0,128) à celle calculée dans le pool génétique du Nord (0,288 ± 0,145). Ainsi, notre analyse confirme les résultats précédents (31-33) et indique que le pool génétique du Nord pourrait avoir été le principal contributeur à la diversité génétique nucléaire des orteils du potager du Pacifique occidental qui existent encore, et qui semblent donc être principalement issus des lignées Camote et Batata (31-33). En outre, les lotypes de la lignée chloroplastique 2 haplotypes étaient principalement représentés dans tout le Pacifique occidental, tout comme le pool génétique nucléaire du Nord. Cependant, la fréquence de la lignée chloroplastique 1 était généralement plus élevée (33%) que celle observée dans le pool génétique du Nord (14,4%). Cela suggère que des clones sud-américains pourraient également avoir été directement introduits dans le Pacifique occidental. Par ailleurs, les effets fondateurs liés à l’histoire de la diffusion et/ou à la sélection locale peuvent avoir augmenté la fréquence de cet haplogroupe dans la zone d’introduction, par rapport à celle observée dans le pool génétique original du Nord déjà mélangé.

En Polynésie, la situation est plus contrastée. En Nouvelle-Zélande, seule la lignée 1 de chloroplastes a été trouvée, et à Hawaï, cette lignée a dominé, un schéma attendu pour les variétés issues du pool génétique du Sud. En revanche, la fréquence de la lignée chloroplastique 1 n’était que de 19,5 % en Polynésie orientale. Si l’on considère les données nucléaires, seules 14 variétés (9 de Polynésie orientale, 1 d’Hawaï et 2 de Nouvelle-Zélande) ont été attribuées au groupe K1 et 103 au groupe K2, et 14 avaient une ascendance mixte (méthode DAPC). Avec la méthode bayésienne de classification, la plupart des accessions (127/131) avaient une ascendance mixte. La proportion moyenne d’ancêtres K1 en Polynésie était de 0,391 (± 0,128) [allant de 0,332 (± 0,095) à Hawaï et 0,388 (± 0,136) en Polynésie orientale à 0,585 (± 0,186) en Nouvelle-Zélande], une valeur significativement plus élevée que celle calculée dans le pool génétique du Nord et du Pacifique occidental (P < 0,01 pour les deux), ce qui atteste de la plus grande contribution du pool génétique du Sud dans cette région. Cependant, seuls sept individus présentaient une constitution génétique clairement héritée du pool génétique du Sud (lignée de chloroplastes 1 et affectation au groupe K1). La plupart des accessions modernes semblent avoir une constitution génétique mixte, «à terme» entre les deux pools géniques.

Les spécimens d’herbier et la lignée Kumara

Nous avons récupéré du matériel provenant de 42 accessions d’herbiers de patates douces collectées dans le monde entier entre le XVIIe siècle et le début du XXe siècle et avons obtenu des données sur les microsatellites chloroplastes pour toutes ces accessions et des données fiables sur les microsatellites nucléaires pour 30 accessions. La quasi-totalité des accessions de Polynésie présentaient un haplotype de la lignée chloroplastique 1 (hap 14) et ont été affectés à l’amas nucléaire K1, un fond génétique caractéristique du pool génétique du Sud (Fig. 2D). En revanche, les spécimens d’herbiers des Caraïbes, d’Asie du Sud-Est et de Madagascar présentaient un haplotype de chloroplaste de lignée 2 (hap1-2) et ont été affectés au groupe nucléaire K2, une constitution génétique probablement héritée du pool génétique du Nord. Les méthodes DAPC et bayésienne ont donné des résultats concordants (Fig. S2). Ce schéma géographique clair soutient fortement l’hypothèse selon laquelle la lignée Kumara représente une diffusion précolombienne de patates douces d’Amérique du Sud (zone Pérou-Équateur) en Polynésie.

Les spécimens collectés par J. Banks et D. Solander lors du premier voyage du capitaine James Cook en 1769 (deux plantes des îles de la Société et une de Nouvelle-Zélande) présentent un intérêt particulier, car ils pourraient représenter des introductions véritablement préhistoriques. Toutes trois sont issues du pool génétique du Sud (Fig. 2D et 3 et Fig. S3). Les deux plantes des îles de la Société sont un seul clone (génotypes multilocus presque identiques). Le spécimen néo-zélandais semble toutefois être une variété distincte, comme l’attestent les caractéristiques morphologiques et comme le confirment nos résultats génétiques (génotypage incomplet mais avec des allèles distincts). D’autres spécimens du début du XXe siècle provenant de la Polynésie orientale se sont également regroupés avec le pool génétique du Sud (Fig. 3 et Fig. S3). Morphologiquement distinguables, ils sont génétiquement assez proches (Fig. 3 et Fig. S3) et pourraient être de véritables représentants de l’âge de la lignée Kumara. Ce résultat confirme la conclusion de Green (26) selon laquelle des lignées distinctes et identifiables étaient déjà présentes en Polynésie à l’époque des premiers contacts européens, ayant probablement, cependant, une base génétique étroite (Fig. 3 et Fig. S3). On ignore encore si ces lignées résultent d’une seule introduction en provenance d’Amérique du Sud ou de multiples introductions dépendantes (comprenant peut-être des voyages en provenance du nord de la Colombie et d’Amérique centrale) (23, 28) et l’échantillon actuel d’accessions d’herbiers ne permet pas d’exclure de multiples introductions préhistoriques.

De l’Antiquité à la modernité : Remaniement du fond génétique initial de la patate douce en Océanie. Dans le Pacifique Est

En comparaison avec tous les spécimens d’herbiers jusqu’au début du 20e siècle, la plupart des variétés contemporaines de Polynésie orientale (80,5 %) portent un haplotype de la lignée chloroplastique 2, ce qui confirme l’affirmation de longue date des ethnobotanistes selon laquelle les introductions ultérieures ont remplacé les variétés initiales de patate douce dans cette région (35, 40). La stabilité relative de la constitution génétique, reflétée par les accessions d’herbiers de la fin du 18e siècle au début du 20e siècle dans cette région, peut indiquer que les réintroductions européennes précoces (par exemple, par les commerçants, les baleiniers et les voyageurs) n’ont pas effacé immédiatement le patrimoine génétique initial. Dans un premier temps, ces mouvements ont peut-être redistribué les clones déjà présents dans la région plutôt que d’introduire de nouveaux génotypes, étendant la dispersion des variétés (dont les Polynésiens eux-mêmes étaient à l’origine) à travers la Polynésie et probablement même plus à l’ouest (24, 35). Ce changement a probablement eu lieu au cours du XXe siècle, sûrement avant les années 1960, lorsque Yen a commencé ses collections.

Capture D’écran 2

Fig. 3. Modèles globaux de différenciation génétique. Arbre de jonction des voisins basé sur la distance de Lynch pour l’ensemble des données mondiales. Les individus sont étiquetés selon leur origine géographique, en orange, bleu, cyan, vert, jaune, magenta et noir pour les accessions de la région sud, de la région nord, de la Polynésie, de l’île de Mélanésie, de la Nouvelle-Guinée, de l’Asie du Sud-Est et des «autres régions» (Micronésie, Madagascar, Madère), respectivement. Les spécimens d’herbiers de Polynésie sont indiqués par des cercles rouges ouverts.

Les schémas de différenciation observés aujourd’hui révèlent que les variétés de Polynésie orientale forment un groupe hétérogène, avec quelques accessions étroitement liées au pool génétique du Sud, certaines au pool génétique du Nord, et d’autres aux variétés prédominantes du Pacifique occidental, tandis que d’autres sont intermédiaires et forment même un groupe bien différencié (Fig. 3 et Fig. S3). Ce groupe comprend certaines lignées clonales (c’est-à-dire des variétés ayant le même haplotype et très peu de différences entre les génotypes) et également des cultivars qui, bien que génétiquement proches, peuvent être issus d’événements de recombinaison sexuelle indépendants. Ce schéma de différenciation génétique suggère que les réintroductions ultérieures n’ont pas simplement remplacé les premières, mais ont plutôt remanié le fond génétique initial. Bien qu’elle soit principalement multipliée par clonage, la patate douce se reproduit par voie sexuelle, et ses plants spontanés sont parfois incorporés par les agriculteurs et multipliés en tant que nouveaux clones (24, 41). Dans les Marquises et à Tahiti, la patate douce n’a longtemps eu qu’une importance secondaire. Au début du XXe siècle, seules quelques variétés indigènes, mal adaptées aux milieux tropicaux humides de la Polynésie orientale, ont été recensées (42). Des goulots d’étranglement génétiques forts, tels que ceux qui ont accompagné la diffusion préhistorique de la culture par les Polynésiens qui ont probablement introduit un nombre limité de groupes d’autoincompatibilité, ont pu limiter considérablement la reproduction sexuelle et la sélection ultérieure de plants par les agriculteurs comme nouveaux clones. Les réintroductions européennes ultérieures ont peut-être permis d’amorcer une diversification locale. Les variétés hawaïennes présentent un schéma assez similaire à celui des variétés de Polynésie orientale, et la plupart d’entre elles font partie du groupe de Polynésie orientale (Fig. S3). De plus, certains clones sont partagés entre les deux régions (Polynésie orientale et Hawaï), ce qui atteste de la circulation des propagules végétatives entre les deux zones. Néanmoins, à Hawaii, les premières références des explorateurs et des commerçants européens ont décrit la patate douce comme un aliment abondant (26), et au début du 20ème siècle, Handy (43) caractérisait un grand nombre de variétés locales. Les introductions préhistoriques indépendantes, ou les premières introductions historiques par les explorateurs espagnols (Fig. 1), ont-elles élargi la base génétique initiale, offrant ainsi assez rapidement des possibilités de recombinaison à grande échelle et de sélection locale de variantes dans cet archipel ? Il est intéressant de noter que les spécimens d’herbiers du début du XXe siècle présentent déjà une constitution «mixte». Malheureusement, nous n’avons identifié aucun spécimen d’herbier hawaïen ancien pour confirmer cette hypothèse. De même, aucune des variétés de Kumara de Nouvelle-Zélande ne se regroupe avec l’amas Polynésie orientale / Hawaï (Fig. S3). Deux cultivars ont été clairement associés au pool génétique du Sud sur la base des deux types de marqueurs et pourraient représenter de véritables kumaras originaux. Deux autres accessions, reconnues par les informateurs maoris comme étant des kumaras indigènes (c’est-à-dire des introductions pré-européennes) sont associées au pool génétique du Nord et peuvent, au contraire, représenter des réintroductions ultérieures.

La diversité génétique moderne en Polynésie résulte donc d’un remaniement local du fond génétique initial avec des réintroductions ultérieures. Le schéma observé reflète également la probabilité que la Polynésie soit longtemps restée relativement isolée du reste du Pacifique. Plus particulièrement, très peu de clones sont partagés entre la Polynésie orientale et le Pacifique occidental. Les mouvements de germoplasme de patate douce entre le Pacifique Est et le Pacifique Ouest étaient assez limités et n’ont pas homogénéisé la diversité génétique de la patate douce en Océanie, un schéma génétique qui reflète bien la frontière culturelle entre la Polynésie et la Mélanésie insulaire.

Dans le Pacifique occidental

En revanche, l’absence de structure géographique parmi les variétés du Pacifique occidental (Fig. 3 et Fig. S3) suggère un fond génétique commun conforme à la thèse tripartite. De plus, ce schéma suggère une large circulation des variétés dans cette région, attestée également par la présence de plusieurs clones communs (Dataset S2). Néanmoins, la valeur moyenne de l’ascendance K1 trouvée en Mélanésie était légèrement plus élevée (0,343 ± 0,113) que celle observée en Nouvelle-Guinée (0,276 ± 0,116) et en Asie du Sud-Est (0,279 ± 0,097), qui présentaient toutes deux des valeurs très similaires à celles observées dans le pool génétique du Nord (tableau S1). La contribution plus importante du pool génétique du Sud en Mélanésie reflète probablement les introductions précoces de véritables clones kumara, ainsi que suggéré par l’utilisation courante des parents de ce terme («kumara/kumala») pour désigner la patate douce dans l’est de la Mélanésie (28, 35). Par ailleurs, les variétés de Nouvelle-Guinée semblent être légèrement différenciées de celles des autres régions du Pacifique occidental. Ces données génétiques, combinées à la présence de nombreux noms apparemment sans rapport les uns avec les autres (24), reflètent probablement les multiples processus de diversification locale dans cette île. De plus, la distribution de fréquence des distances Manhattan par paires pour les génotypes du Pacifique occidental (Fig. S4) suggère que la grande diversité de cette région semble avoir résulté, comme le soupçonne le Yen (25), d’une recombinaison intensive entre les introductions et de l’utilisation par les agriculteurs de plantes issues de vraies semences, plutôt que de l’évolution clonale et de la sélection par les agriculteurs de mutants somatiques.

Les gènes et les noms se sont-ils dispersés ensemble ?

Le système de reproduction mixte clonal/sexuel de la patate douce permet une recombinaison fréquente des génotypes nouvellement introduits avec le matériel local. Dans ces génotypes recombinés, le nom suit probablement le phénotype. Les phénotypes distinctifs peuvent refléter des allèles sur des locus qui font l’objet d’une forte sélection et peuvent ne présenter aucune corrélation avec le fond génétique neutre largement remanié. Ainsi, les anciens noms peuvent continuer à être appliqués aux variétés qui ont été fortement affectées par le mouvement moderne des plantes et la recombinaison locale. C’est ce qui est probablement arrivé à la plupart des variétés polynésiennes «indigènes» originaires d’Amérique du Sud, qui ont été progressivement mélangées à du matériel introduit beaucoup plus tard. Une illustration de ce scénario évolutif peut être offerte par le groupe d’anciennes patates douces polynésiennes nommé Convolvulus chrysorrhizus dulcis par D. Solander (et suivi par J. Forster) en raison de la couleur jaune vif de la chair interne des racines. En 1960, Yen a identifié deux groupes très similaires de variétés jaunes (chair interne jaune et racine fusiforme) avec une distribution pan-polynésienne (les groupes «re’amoa» et «hererai») et considérés par les populations locales comme des kumaras indigènes (25, 26). Alors que la variété jaune «indigène» décrite par Banks et Solander porte un haplotype de la lignée chloroplastique 1, toutes les variétés jaunes contemporaines portent un haplotype de la lignée chloroplast 2 et sont très proches les unes des autres, formant très certainement une lignée clonale ou un groupe de variétés génétiquement proches. La base génétique neutre s’est probablement déplacée, alors que le phénotype initial et les noms initiaux semblent avoir été bien conservés. Ainsi, les génotypes et les noms ne migrent pas toujours ensemble, et les informations sur chacun donnent accès à des parties complémentaires de l’histoire de la dispersion de la plante.

Conclusion

Notre étude a montré comment les collections historiques révèlent des modèles de diffusion de la patate douce en Océanie qui ont été masqués par les mouvements modernes des plantes et la recombinaison locale. Nos résultats apportent un solide soutien génétique, qui faisait défaut auparavant, à l’hypothèse tripartite, notamment en ce qui concerne la lignée kumara, la diffusion précolombienne de patates douces d’Amérique du Sud en Polynésie. Nous suggérons également pourquoi les phénotypes, les noms et les gènes neutres ne partagent pas nécessairement des histoires évolutives complètement parallèles. Alors que les anciens noms et les anciens phénotypes peuvent perdurer, la recombinaison peut largement remanier leurs arrière-plans génétiques neutres et camoufler les voies de diffusion initiale.

L’exploitation des cultures en tant que substitut des mouvements humains en Océanie nécessite des approches multidisciplinaires combinant la linguistique, la caractérisation morphologique des plantes et la phylogéographie, dans lesquelles l’utilisation des collections d’herbiers peut jouer un rôle essentiel.

Matériels et méthodes

Échantillonnage et génotypage

Nous avons analysé un total de 1 245 accessions de patates douces dans toute l’Amérique tropicale et l’Océanie, y compris certaines accessions d’Asie du Sud-Est et de Madagascar (1 188 accessions modernes provenant de plusieurs collections ex situ importantes représentant la variabilité existante en Océanie et un total de 57 spécimens d’herbiers de patates douces). La diversité génétique a été évaluée en utilisant six locus microsatellites chloroplastes et 11 locus microsatellites nucléaires. Pour les spécimens d’herbiers, l’extraction et le traitement pré-PCR ont été effectués dans une salle séparée spécialement conçue pour l’ADN dégradé (44) (voir le texte SI et les ensembles de données S3 et S4 pour plus de détails).dans les deux régions.

Évaluation des relations génétiques entre les pools génétiques océaniens et tropicaux américains à l’aide de données sur le chloroplaste et le nucléaire

Nous avons construit la médiane des réseaux de jonction des haplotypes d’Amérique tropicale et d’Océanie à l’aide du logiciel Network 4.5.6.1 (45) (http://www.fluxus-en- gineering.com/ sharenet.htm) et comparé les proportions d’haplotypes de chaque lignée de chloroplastes dans les deux régions.

Nous avons ensuite eu recours à deux types de méthodes pour affecter les variétés océaniennes à leurs pools de gènes de source néotropicale sur la base de données nucléaires. Tout d’abord, nous avons utilisé une méthode non basée sur un modèle, le DAPC, une analyse multivariée récemment développée et mise en œuvre dans le paquet Adegenet R (38). Nous avons effectué la DAPC sur l’ensemble de données tropicales américaines, en utilisant des variétés océaniennes comme individus supplémentaires, en retenant cinq composantes principales (29,3 % de la variance totale) pour la transformation préalable des données, pour K = 2 (regroupement préalable obtenu selon l’algorithme de regroupement K-means mis en œuvre dans le paquet Adegenet) (voir l’annexe SI pour plus de détails). Nous avons comparé l’affectation des DAPC avec celle obtenue par une méthode basée sur un modèle bayésien implémentée dans le logiciel Structure 2.3.3, récemment adapté pour traiter les données autopolyploïdes (39, 40). En préspécifiant les pools de gènes sources en Amérique tropicale (tels que définis par le groupement K-means pour K = 2), l’algorithme estime l’ascendance pour des individus supplémentaires (de Oceania), en mettant à jour les fréquences des allèles en utilisant uniquement ceux d’Amérique tropicale. Nous avons exécuté le modèle de mélange avec K = 2 (même groupement que pour DAPC), des fréquences d’allèles corrélées, 50 000 itérations de brûlage et 150 000 étapes de la chaîne de Markov-Monte Carlo, et avec le codage des données pour traiter l’ambiguïté du génotype pour les marqueurs co-dominants dans les polyploïdes (40). Un individu est considéré comme étant bien attribué à son pool génétique source (K1 ou K2) si la probabilité d’appartenance associée (DAPC) ou la valeur d’ascendance (regroupement bayésien) est supérieure à 0,8 ; sinon, l’individu est considéré comme «mélangé».

La structure génétique mondiale a également été caractérisée par la construction d’un arbre de liaison des voisins basé sur la distance de Lynch [avec le progiciel APE R (46)] et son édition avec le logiciel Darwin 5.0.158 (http://darwin.cirad.fr/darwin). Les indices de diversité classiques, ainsi que les distances de Manhattan par paires, ont été calculés à l’aide de scripts R personnalisés.

2. Remerciements

Nous remercions Marc Spencer, Jonathan Gregson et Jacek Wajer (Musée d’histoire naturelle, Angleterre), David Goyder et Felix Forest (Jardins botaniques royaux, Angleterre), Gerard Thijsse (National Herbarium Nederland, Pays-Bas) et Napua Harbottle (Bishop Museum, Hawaï) pour avoir fourni des spécimens d’herbiers. Nous remercions également Toru Kumagai (Institut national des sciences agronomiques, Japon), Maurice Wong (Services de développement rural, Tahiti) et Wulf Schiefenhövel (Institut Max-Planck d’ornithologie, Allemagne) pour leur aide dans l’échantillonnage de matériel “moderne” de patate douce. Nous remercions également deux réviseurs pour leurs commentaires très utiles. Les données utilisées dans ce travail ont été produites grâce aux installations techniques du Centre méditerranéen pour l’environnement et la biodiversité, France. Cette étude a été financée par des subventions des “Fonds du Pacifique”, distribués par le ministère français des Affaires étrangères et européennes ; le projet SYNTHESYS (Synthèse des ressources systématiques ; www.synthesys.info), qui est financé par l’action “Infrastructure de recherche de la Communauté européenne” dans le cadre du septième programme-cadre, a également apporté son soutien. C.R. a bénéficié d’une bourse doctorale du Ministère français de l’enseignement supérieur et de la recherche.

  1. Hurles ME, Matisoo-Smith E, Gray RD, Penny D (2003) Untangling oceanic settlement: The edge of the knowable. Trends Ecol Evol 18(10):531–540.

  2. Kirch PV (2010) Peopling of the Pacific: A holistic anthropological perspective. Annu Rev Anthropol 39:131–148.

  3. Thorsby E (2012) The Polynesian gene pool: An early contribution by Amerindians to Easter Island. Philos Trans R Soc Lond B Biol Sci 367(1590):812–819.

  4. Kayser M (2010) The human genetic history of Oceania: Near and remote views of dispersal. Curr Biol 20(4):R194–R201.

  5. Matisoo-Smith E, et al. (1998) Patterns of prehistoric human mobility in polynesia indicated by mtDNA from the Pacific rat. Proc Natl Acad Sci USA 95(25):15145–15150.

  6. Matisoo-Smith E, Robins JH (2004) Origins and dispersals of Pacific peoples: Evidence from mtDNA phylogenies of the Pacific rat. Proc Natl Acad Sci USA 101(24):9167–9172.

  7. Erickson DL, Smith BD, Clarke AC, Sandweiss DH, Tuross N (2005) An Asian origin for a 10,000-year-old domesticated plant in the Americas. Proc Natl Acad Sci USA 102(51): 18315–18320.

  8. Clarke AC, Burtenshaw MK, McLenachan PA, Erickson DL, Penny D; SMBE Tri-National Young Investigators (2006) Proceedings of the SMBE Tri-National Young Investigators’ Workshop 2005. Reconstructing the origins and dispersal of the Polynesian bottle gourd (Lagenaria siceraria). Mol Biol Evol 23(5):893–900.

  9. Perrier X, et al. (2011) Multidisciplinary perspectives on banana (Musa spp.) domes- tication. Proc Natl Acad Sci USA 108(28):11311–11318.

  10. Storey AA, et al. (2007) Radiocarbon and DNA evidence for a pre-Columbian introduction of Polynesian chickens to Chile. Proc Natl Acad Sci USA 104(25):10335–10339.

  11. Gongora J, et al. (2008) Indo-European and Asian origins for Chilean and Pacific chickens revealed by mtDNA. Proc Natl Acad Sci USA 105(30):10308–10313.

  12. Larson G, et al. (2007) Phylogeny and ancient DNA of Sus provides insights into neolithic expansion in Island Southeast Asia and Oceania. Proc Natl Acad Sci USA 104(12):4834–4839.

  13. Moodley Y, et al. (2009) The peopling of the Pacific from a bacterial perspective. Science 323(5913):527–530.

  14. Storey A, Clarke AC, Matisoo-Smith E (2011) Polynesians in America: Pre-Columbian Contacts with the New World, eds Jones TL, Storey A, Matisoo-Smtih E, Ramirez-Aliaga JM (AltaMira Press, Plymouth, UK).

  15. Lawler A (2010) Beyond Kon-Tiki: Did Polynesians sail to South America? Science 328(5984):1344–1347.

  16. Austin DF (1988) The taxonomy, evolution and genetic diversity of sweet potatoes and related wild species. in Exploration, Maintenance and Utilization of Sweet Potato Genetic Resources: Report of the First Sweet Potato Planning Conference 1987 (In- ternational Potato Center, Lima, Peru), pp 27–59. Available at http://cipotato.org/library/pdfdocs/SW19066.pdf. Accessed January 4, 2013.

  17. Hather JG, Kirch PV (1991) Prehistoric sweet potato (Ipomoea batatas) from Mangaia Island, central Polynesia. Antiquity 65:887–893.

  18. Ladefoged TN, Graves MW, Coil J (2005) The introduction of sweet potato in Polynesia: Early remains in Hawaii. J Polyn Soc 114(4):359–374.

  19. Horrocks M, Rechtman RB (2009) Sweet potato (Ipomoea batatas) and banana (Musa sp.) microfossils in deposits from the Kona Field System, island of Hawaii. J Archaeol Sci 36(5):1115–1126.

  20. Wallin P, Stevenson C, Ladefogded T (2005) The Sweet Potato in Oceania: A Reappraisal, eds Ballard C, Brown P, Bourke RM, Harwood T (Oceania Publications, Sydney), pp 85–88.

  21. Horrocks M, Shane PA, Barber IG, D’Costa DM, Nichol SL (2004) Microbotanical remains reveal Polynesian agriculture and mixed cropping in early New Zealand. Rev Palaeobot Palynol 131(3-4):147–157.

  22. Scaglion R (2005) The Sweet Potato in Oceania: A Reappraisal, eds Ballard C, Paula B, Bourke RM, Harwood T (Oceania Publications, Sydney), pp 35–42.

  23.  Montenegro Á, Avis C, Weaver A (2008) Modeling the prehistoric arrival of the sweet potato in Polynesia. J Archaeol Sci 35(2):355–367.

  24. Barrau J (1957) L’énigme de la patate douce en Océanie. Etudes d’Outre-Mer 40:83–87. 25.

  25. Yen DE (1974) The Sweet Potato in Oceania: An Essay in Ethnobotany (Bishop Museum Press, Honolulu).

  26. Green R (2005) The Sweet Potato in Oceania: A Reappraisal, eds Ballard C, Brown P, Bourke RM, Harwood T (Oceania Publications, Sydney), pp 43–62.

  27. Clarke A (2009) Origins and dispersal of the Sweet potato and bottle gourd in Oceania: Implications for prehistoric human mobility. PhD thesis (Massey Univ, Palmerston North, New Zealand).

  28. Rensch KH (1991) Polynesian Plant Names: Linguistic Analysis and Ethnobotany, Expectations and Limitations, eds Cox P, Banack S (Dioscorides Press, Portland), pp 97–111.

  29. Allen MG (2005) The Sweet Potato in Oceania: A Reappraisal, eds Ballard C, Brown P, Bourke RM, Hardwood T (Oceania Publications, Sydney), pp 99–108.

  30. Baert AMG (2001) Histoire de la Découverte des Régions Australes: Les Salomon, Marquises, Santa Cruz, Tuamotu, Cook du Nord et Vanuatu (l’Harmattan, Paris).

  31. Zhang D, Ghislain M, Huam Z, Golmirzaie A, Hijmans R (1998) RAPD variation in sweetpotato (Ipomoea batatas (L.) Lam.) cultivars from South America and Papua New Guinea. Genet Resour Crop Evol 45(3):271–277.

  32. Zhang D, Rossel G, Kriegner A, Hijmans R (2004) AFLP assessment of diversity in sweet-potato from Latin America and the Pacific region: Its implications on the dispersal of the crop. Genet Resour Crop Evol 51(2):115–120.

  33. Gichuki ST, et al. (2003) Genetic diversity in sweetpotato [Ipomoea batatas (L.) Lam. in relationship to geographic sources as assessed with RAPD markers. Genet Resour Crop Evol 50(4):429–437.

  34. Roullier C, Rossel G, Tay D, McKey D, Lebot V (2011) Combining chloroplast and nuclear microsatellites to investigate origin and dispersal of New World sweet potato landraces. Mol Ecol 20(19):3963–3977.

  35. Yen DE (1998) Subsistence to commerce in Pacific agriculture: Some four thousand years of plant exchange. Plants for Food and Medicine, eds Pendergast HDV, Etkin NL, Harris DR, Houghton PJ (Royal Botanical Garden, Kew, UK).

  36. Matisoo-Smith E (2002) Something old, something new: Do genetic studies of contemporary populations reliably represent prehistoric populations of Pacific Rattus exulans ? Hum Biol 74(3):489–496.

  37. Jombart T, Devillard S, Balloux F (2010) Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. BMC Genet 11:94.

  38. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155(2):945–959.

  39. Falush D, Stephens M, Pritchard JK (2003) Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics 164(4):1567–1587.

  40. Barrau J (1961) Subsistence Agriculture in Polynesia and Micronesia (Bernice P. Bishop Museum, Honolulu).

  41. Schneider J (1995) Indigenous Knowledge in Conservation of Crop Genetic Resources: Proceedings of an International Workshop, Held in Cisarua, Bogor, Indonesia, January 30–February 3, 1995 (Central Research Institute for Food Crops, Bogor, Indonesia), pp 63–70.

  42. Brown FBH (1935) Flora of Southeastern Polynesia (Bernice P. Bishop Museum, Hon- olulu), Vol 3.

  43. Handy ESC (1940) The Hawaiian Planter. His Plants, Methods and Areas of Cultivation (Bernice P. Bishop Museum, Honolulu), Vol 1.1

  44. Knapp M, Clarke AC, Horsburgh KA, Matisoo-Smith EA (2012) Setting the stage – building and working in an ancient DNA laboratory. Ann Anat 194(1):3–6.

  45. Bandelt HJ, Forster P, Röhl A (1999) Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16(1):37–48.

  46. Paradis E, Claude J, Strimmer K (2004) APE: Analyses of phylogenetics and evolution in R language. Bioinformatics 20(2):289–290.

 

Informations complémentaires

SI Texte

Échantillonnage

Les 1.188 accessions “modernes” de plusieurs collections importantes ex situ, rassemblées entre 1960 et 2011, sont:

– La collection de patates douces Yen rassemblée dans les années 1960 par D. Yen et conservée à l’Institut national des sciences des cultures à Tsukuba, au Japon.
– Les collections des Highlands et des Lowlands (HAES et LAES) de l’Institut national de recherche agricole de Papouasie-Nouvelle-Guinée, collectées pour la plupart dans les années 1980, et conservées à la Station d’expérimentation agricole des Highlands (HAES) à Aiyura dans la province des Highlands de l’Est et à la Station d’expérimentation agricole des Lowlands (LAES) à Keravat dans l’Est de la Nouvelle-Bretagne.
– La collection du Centre international de la pomme de terre (CIP) à Lima, au Pérou.
– La collection du Vanuatu rassemblée en 2008 et conservée au Centre agronomique et technique du Vanuatu à Port Vila (CTRAV), Vanuatu.
– La collection polynésienne, rassemblée en 2011 dans toute la Polynésie française et conservée dans les services de développement rural (SDR), à Papeete, Tahiti.
– Les races terrestres hawaïennes récupérées dans deux jardins botaniques, l’Arboretum de Lyon de l’Université d’Hawaï (HLA) (île d’Oahu), et le jardin botanique de Waimea (WBG) (île de Waimea).
Nous avons également inclus quelques variétés de Nouvelle-Guinée collectées par Wulf Schiefenhövel (WS) dans deux villages de l’Eipo sur les hauts plateaux de l’ouest de la Nouvelle-Guinée (province indonésienne de Papouasie).
De jeunes feuilles saines ont été collectées à partir d’accessions principalement cultivées dans des serres ou des champs, séchées (sauf pour le matériel de l’Eipo, qui a été conservé dans du sel) dans un four à 37 °C pendant 2 jours ou lyophilisées, puis conservées dans du gel de silice.
L’ensemble de données S3 fournit une liste de ce matériel et comprend les noms des collections ex situ (Yen, HAES, LAES, CIP, CTRAV, SDR, WS, HLA, WBG) et des données complètes sur l’origine géographique et le nom de la race locale, ainsi que les résultats des analyses génétiques pour le chloroplaste et les données nucléaires.
Nous avons également rassemblé un total de 57 spécimens d’herbiers recueillis avant 1978, dont 15 peuvent être considérés comme modernes (après la fin de la Seconde Guerre mondiale) et 42 spécimens du 17e au début du 20e siècle, y compris des spécimens historiques de l’herbier du premier voyage de Cook, conservés au British Museum de Londres. L’ensemble de données S4 énumère les spécimens d’herbiers analysés dans le cadre de notre étude et comprend le code de l’herbier, l’origine géographique, la date de collecte, le nom du collectionneur et d’autres informations pertinentes figurant sur la fiche de l’herbier, ainsi que les résultats des analyses génétiques. Génotypage. Toute l’extraction et le traitement pré-PCR des spécimens d’herbier ont été effectués dans une salle séparée et isolée, spécialement conçue pour l’ADN dégradé, avec des précautions prises pour éviter et identifier toute contamination potentielle (1).

1. Knapp M, Clarke AC, Horsburgh KA, Matisoo-Smith EA (2012) Setting the stage – building and working in an ancient DNA laboratory. Ann Anat 194(1):3-6.

Extraction de l’ADN

Pour les spécimens d’herbiers, les extractions ont été réalisées à partir de tissus foliaires secs avec le Qiagen DNeasy mini Plant Kit (250), avec une période de lyse de nuit. L’ADN a été élué dans 100 μL de Tris-EDTA (TE). Les spécimens ont été extraits par séries de 12 échantillons, une série par jour pour éviter les contaminations, et deux contrôles d’extraction négatifs ont été effectués pour chaque série d’extractions.

Pour les échantillons modernes, l’extraction de l’ADN a été réalisée avec le kit Qiagen 96 Plant pour les tissus lyophilisés.

Amplification PCR

Les échantillons modernes ont été génotypés sur 11 locus de microsatellites nucléaires (J263, J315E, J522A, J116a, Ib297, J206A, J1809E, IbR16, IbC5, J544b, IbS11) et 4 micro-satellites de chloroplastes (cp) décrits dans Roullier et al. (2). Deux crosatellites universels de cp (ccmp2 et ntcp28) utilisés dans Roullier et al. (2) ont été remplacés par de nouvelles paires d’amorces [ibcp4 : ATCCTGGACGTGAA- GAATAA (en avant) et GATGGCTGAGTGGACTAAAG (en arrière) ; ibcp31 : AAACGGATTTCTCCAATGTA (en avant) et ACCTCACCGTTTCAGAAGTA (en arrière)] spécifiquement conçues à partir du génome du chloroplaste Ipomoea purpurea et donnant des résultats d’amplification plus efficaces. Tous les locus ont été amplifiés de manière indépendante en utilisant la PCR multiplex Taq (Qiagen) dans un volume final de 10 μL, en utilisant 30 ng d’ADN par réaction. Le programme suivant a été réalisé à l’aide d’un thermocycleur PTC-100 (MJ Research) : 15 min à 95 °C ; 35 cycles de 30 s à 94 °C, 90 s à 57 °C, et 1 min à 72 °C ; et, enfin, 30 min à 72 °C.

Pour les spécimens d’herbiers, les mêmes locus chloroplastiques et nucléaires ont été amplifiés indépendamment, en utilisant la PCR multiplex Taq (Qiagen) dans un volume final de 10 μL, avec 2 μL de 1:10 ADN de concentration inconnue, en ajoutant 0,1 μL de 100× BSA. Les conditions de PCR programme étaient presque identiques, mais nous avons effectué, au total, 50 cycles.

Comme nous nous attendions à des problèmes de reproductibilité pour l’amplification de l’ADN dégradé, nous avons reproduit chaque amplification. Pour les locus de chloroplastes haploïdes, nous avons amplifié chaque individu deux fois indépendamment. Pour les locus nucléaires hexaploïdes, nous avons répliqué chaque amplification entre deux et cinq fois (selon la priorité donnée à l’échantillon).

Les produits d’amplification ont été analysés avec un séquenceur capillaire ABI 3130 XL 16- (ABI Prism ; Applied Biosystems), et le marquage des allèles a été vérifié par deux chercheurs utilisant le Genemapper (Applied Biosystems).

Notation des allèles des spécimens d’herbiers

Pour le scoring des chloroplastes, nous avons conservé les allèles reproductibles (c’est-à-dire ceux présents dans les deux reproductions) et n’avons conservé que les accessions avec des données complètes.

Pour les locus nucléaires, nous avons utilisé différentes notations : la plus rigoureuse (1 dans l’ensemble de données S4), dans laquelle nous avons conservé les allèles qui étaient présents au moins trois fois sur l’ensemble des réplicats (maximum de cinq) ; et la seconde (2 dans l’ensemble de données S4), dans laquelle nous avons conservé les allèles qui étaient présents au moins deux fois. Nous avons inclus dans l’analyse génétique uniquement les accessions pour lesquelles nous avons obtenu des informations fiables pour au moins 5 des 11 locus. Le nombre de données manquantes (locus manquants) est indiqué dans l’ensemble de données S4. Tous les spécimens d’herbier n’ont pas permis d’obtenir la même qualité et la même fiabilité de notation pour le génotypage nucléaire.

2. Roullier C, Rossel G, Tay D, McKey D, Lebot V (2011) Combinaison de chloroplastes et de microsatellites nucléaires pour étudier l’origine et la dispersion des races de patate douce du Nouveau Monde. Mol Ecol 20(19):3963-3977.

Capture D’écran 3

Fig. S1. Comparaison entre les réseaux de jonction médians obtenus pour les accessions tropicales américaines (A) et océaniennes (B). La taille des cercles est proportionnelle au nombre d’accessions qui portent un haplotype donné. Les haplotypes des lignées 1 et 2 du chloroplaste (cp) sont colorés en orange et en bleu, respectivement. Les haplotypes océaniens privés sont indiqués en gris. La longueur de la ligne entre deux haplotypes distincts est proportionnelle au nombre de mutations qui les séparent. Les variétés de patate douce d’Océanie représentent un sous-ensemble de la diversité des chloroplastes néotropicaux. Elles comprennent des représentants des lignées de cp 1 et 2 (au total, sept haplotypes différents, y compris les plus courants en Amérique tropicale) et également quelques haplotypes privés (huit), tous rares et dérivés des plus courants par seulement une ou deux étapes de mutation.

Capture D’écran 4

Fig. S2. Diagrammes en barres montrant les probabilités d’appartenance aux groupes nucléaires K1 (orange) et K2 (bleu), telles que déterminées par la méthode bayésienne (A), et la valeur d’ascendance dans les groupes nucléaires K1 (orange) et K2 (bleu), telle que déterminée par la méthode d’analyse discriminante des composantes principales (B), pour les anciens spécimens d’herbier (du 17e au début du 20e siècle).

Fig. S3. Représentation hiérarchique de l’arbre radial (Fig. 3) montrant uniquement les accessions de la région sud (en orange), de la région nord (en bleu) et de la Polynésie [Polynésie orientale en magenta, Hawaii en violet, Nouvelle-Zélande en rouge et Polynésie occidentale (Tonga) en vert]. Les étiquettes d’adhésion comprennent le nom de la collection (Y pour la collection Yen, CIP pour la collection du Centre international de la pomme de terre, HG pour les accessions au Jardin botanique d’Hawaï, H pour les spécimens d’herbiers, et SDR pour la collection de Polynésie française conservée au service du développement rural), le numéro de l’échantillon (mentionné dans les ensembles de données S3 et S4), l’origine géographique (pays ou archipel), le nom local s’il a été déterminé, l’haplotype d’ADN de chloroplaste (cp) et le groupe nucléaire associé, tel que déterminé par l’analyse DAPC globale (pour K = 12). La patate douce présente un système de reproduction mixte clonal/sexuel. Ainsi, les génotypes nouvellement introduits devraient souvent se recombiner avec le matériel local. Dans ces génotypes recombinés, le nom du cultivar suit probablement le phénotype. Les phénotypes distinctifs peuvent refléter des allèles sur des loci qui sont soumis à une forte sélection et peuvent ne présenter aucune corrélation avec le fond génétique neutre, largement remanié. Ainsi, les anciens noms peuvent continuer à être appliqués aux races primitives qui ont été fortement affectées par le mouvement moderne des plantes et la recombinaison locale. C’est ce qui est probablement arrivé à la plupart des variétés polynésiennes “indigènes” originaires d’Amérique du Sud, qui ont été progressivement mélangées à du matériel introduit beaucoup plus tard. Le groupe de patates douces polynésiennes anciennes classées comme Convolvulus chrysorrhizus dulcis par D. Solander et ensuite par J. Forster, en raison de la couleur jaune vif de leur chair interne, offre une illustration de ce scénario évolutif. En 1960, Yen a identifié deux groupes très similaires de variétés jaunes (chair interne jaune et racine fusiforme) ayant une distribution pan-polynésienne (les groupes “re’amoa” et “hererai“) et considérés par les populations locales comme des kumaras indigènes (1, 2). Alors que la variété jaune “indigène” décrite par Banks et Solander porte un haplotype de la lignée chloroplastique 1, toutes les variétés jaunes con- temporaires portent un haplotype de la lignée chloroplastique 2 et sont très proches les unes des autres, formant probablement une lignée clonale ou un groupe de variétés génétiquement proches, ce qui confirme les soupçons concernant le yen (1). La base génétique neutre s’est déplacée, alors que le phénotype initial, et probablement les noms initiaux, ont pu être bien conservés. Le même scénario s’est probablement produit pour les cultivars maoris. Trois cultivars sont reconnus par les informateurs maoris comme étant des kumaras indigènes, c’est-à-dire des introductions pré-européennes. Il s’agit des cultivars “rekamoroa“, “taputini” et “hutihuti“. Une étude génétique antérieure utilisant des marqueurs RAPD a montré que rekamoroa et hutihuti étaient très proches et taputini assez distinct (3), tandis que Yen a suggéré, pour des raisons morphologiques, que hutihuti et taputini étaient étroitement liés (1). Une étude génétique récente basée sur les marqueurs de polymorphisme de longueur de fragment amplifié (AFLP) a montré qu’aucun de ces cultivars ne se regroupe avec d’autres variétés de Polynésie orientale (4). L’auteur de cette dernière étude a conclu qu’aucun de ces cultivars ne peut être issu de véritables introductions préhistoriques mais, au contraire, d’introductions européennes, comme la majorité des cultivars commerciaux néo-zélandais (le groupe waina). Nous avons obtenu des résultats similaires : le groupe waina et les cultivars rekamoroa et taputini se sont regroupés avec des accessions du pool génétique du Nord et non avec le groupe d’accessions de Polynésie orientale, ce qui suggère qu’ils sont issus de dernières introductions européennes. Cependant, les accessions du cultivar hutihuti se sont regroupées avec les accessions du pool génétique du Sud, tout comme les spécimens d’herbiers historiques de Polynésie orientale. Seul ce dernier cultivar peut représenter un véritable kumara natif. Cependant, Clarke (4) a révélé quelques problèmes d’identification erronée entre des collections indépendantes (même cultivar avec des noms différents dans les deux collections) au Japon et en Nouvelle-Zélande, ce qui complique l’interprétation des données génétiques. Ainsi, avant de pouvoir tirer des conclusions sur ce sujet débattu, les enquêtes doivent d’abord vérifier les véritables identités (noms) des plantes concernées, en croisant les informations provenant du Yen (1) et les données sur les caractéristiques agromorphologiques des plantes vivantes. Des variétés polynésiennes ont été décrites en détail à Hawaï, en Polynésie orientale et en Nouvelle-Zélande dans les premières décennies du XXe siècle. Certains de ces cultivars sont conservés à l’herbier du Bishop Museum. Dans les collections ex situ modernes (réunies après les années 1960), certains noms de cultivars sont encore identiques à ceux qui figuraient dans les anciennes descriptions. Il serait intéressant de comparer les caractéristiques morphologiques actuelles et passées, ainsi que la variation génétique évaluée par des marqueurs neutres, pour examiner le remaniement des kumaras polynésiens initiaux avec les introductions européennes ultérieures.

  1. Yen DE (1974) The Sweet Potato in Oceania: An Essay in Ethnobotany (Bishop Museum Press, Honolulu).

  2. Green R (2005) The Sweet Potato in Oceania: A Reappraisal, eds Ballard C, Brown P, Bourke RM, Harwood T (Oceania Publications, Sydney), pp 43–62.

  3. Harvey C, Gill G, Crossman C, Fraser L (1997) Assessing relationships of kumara cultivars by RAPD analysis. NZ J Bot 35(4):479–485.

  4. Clarke A (2009) Origins and Dispersal of the Sweet Potato and Bottle Gourd in Oceania: Implications for Prehistoric Human Mobility. PhD thesis (Massey Univ, Palmerston North, New Zealand)

Capture D’écran 7

Fig. S4. Distribution de fréquence de la dissimilarité génétique basée sur le calcul de toutes les distances de Manhattan par paires entre les génotypes au sein des races terrestres du Pacifique occidental et de la Polynésie. Le premier sommet de chaque courbe bimodale représente les clones (dissimilitudes par paires égales à 0), les variantes possibles par mutations somatiques, et/ou les erreurs de notation. La deuxième partie de chaque courbe représente les individus qui sont très probablement issus d’événements de recombinaison sexuelle indépendants. La valeur moyenne de la distance par paire et son écart-type sont fournis pour chaque région.

Capture D’écran 9

Tableau S1. Comparaison de la diversité nucléaire et chloroplastique entre l’Amérique tropicale et l’Océanie

Dossiers supplémentaires